The ORFI Type

The ORFI type in GeneFinder is designed to enforce stricter validation, preventing the creation of incompatible instances. This ensures greater stability and consistency when working with open reading frames (ORFs). For example, attempting to create an ORFI with invalid parameters will result in an error:

ORFI{4,NaiveFinder}(1:10, '+', 4) # Or any F <: GeneFinderMethod

ERROR: MethodError: no method matching OpenReadingFrameInterval{4, NaiveFinder}(::UnitRange{Int64}, ::Char, ::Int64)
The type `OpenReadingFrameInterval{4, NaiveFinder}` exists, but no method is defined for this combination of argument types when trying to construct it.

Closest candidates are:
  (::Type{OpenReadingFrameInterval{N, F}} where {N, F<:GeneFinder.GeneFinderMethod})(::Any, ::Any, ::Any, ::Any, ::Any, ::Any, ::Any)
   @ GeneFinder ~/.julia/dev/GeneFinder/src/types.jl:51
  OpenReadingFrameInterval{N, F}(::Type{F}, ::String, ::Int64, ::Int64, ::GenomicFeatures.Strand, ::Int8, ::BioSequences.LongSubSeq{BioSequences.DNAAlphabet{N}}, ::NamedTuple) where {N, F<:GeneFinder.GeneFinderMethod}
   @ GeneFinder ~/.julia/dev/GeneFinder/src/types.jl:64

Stacktrace:
 [1] top-level scope
   @ REPL[3]:1

Validation Rules

The ORFI type enforces the following rules:

• The strand must be either + or -. Any other value will trigger an error.

• Parameters must align with the expected structure of an open reading frame.

These safeguards help prevent the creation of invalid ORFs, making the system more robust and easier to extend.

Example Usage

Here is an example of creating a valid ORFI instance:

ORFI{4,NaiveFinder}(
    "seq", 
    1, 
    33, 
    STRAND_POS, 
    1, 
    convert(LongSubSeq, dna"ATGATGCATGCATGCATGCTAGTAACTAGCTAG"), 
    NamedTuple()
)

This instance can then be used to iterate over a sequence of interest and verify whether the ORFI is contained within the sequence.

Warning

While the ORFI type ensures stricter validation, it is still possible to create an ORFI that does not correspond to an actual open reading frame in the sequence. This limitation will be addressed in future versions of the package. However, the current implementation provides the benefit of retrieving the corresponding subsequence in a convenient 5' to 3' orientation, regardless of the strand.